|
| |
 |
|
| ORIGINAL ARTICLE |
|
| Year : 2019 | Volume
: 12
| Issue : 2 | Page : 67-71 |
|
Occurrence of Chlamydia spp. in wild birds in Thailand
Suksai Parut1, Onket Rattanaporn2, Wiriyarat Witthawat3, Sangkachai Nareerat1, Lekcharoen Paisin1, Sariya Ladawan1
1 The Monitoring and Surveillance Center for Zoonotic Diseases in Wildlife and Exotic Animals, Faculty of Veterinary Science, Mahidol University, Salaya, Nakhon Pathom, Thailand
2 Faculty of Veterinary Technology, Kasetsart University, Ngam Wong Wan Road, Lat Yao, Chatuchak, Bangkok, Thailand
3 The Monitoring and Surveillance Center for Zoonotic Diseases in Wildlife and Exotic Animals, Faculty of Veterinary Science, Mahidol University, Salaya; Department of Preclinical Sciences and Applied Animal Sciences, Faculty of Veterinary Science, Mahidol University, Nakhon Pathom 73170, Thailand
| Date of Submission | 31-Oct-2018 |
| Date of Decision | 28-Dec-2018 |
| Date of Acceptance | 15-Jan-2019 |
| Date of Web Publication | 01-Feb-2019 |
Correspondence Address:
Sariya Ladawan
The Monitoring and Surveillance Center for Zoonotic Diseases in Wildlife and Exotic Animals, Faculty of Veterinary Science, Mahidol University, Salaya, Nakhon Pathom 73170
Thailand
 Source of Support: None, Conflict of Interest: None
DOI: 10.4103/1995-7645.250839
Objective: To determine the occurrence of Chlamydia spp. in wild birds in Thailand. Methods: Cloacal and tracheal swabs of 313 wild birds from 11 orders, 27 families, and 51 species were tested to determine the occurrence of Chlamydia infection. The outer membrane protein A (ompA) gene was amplified from positive samples to construct a phylogenetic tree. Results: At the time of sample collection, none of the birds showed clinical signs of any disease. Of 313 wild birds, two Asian openbill stork (Anastomus oscitans) were positive for Chlamydia spp., representing 0.64% (2/313) and 4.9% (2/41) occurrence for birds overall and for the Asian openbill stork, respectively. Phylogram analysis based on deduced amino acid of the ompA gene showed that Chlamydia spp. in Asian openbill storks was closely related to that in wildfowl (Pica pica and Cygnus olor) from Poland in a different branch with a 95% bootstrap value and had a shorter evolutionary distance to Chlamydia abortus. Conclusions: Asymptomatic Asian openbill storks could be a potential source of Chlamydia infection in domestic animals, poultry, and humans who share their habitat.
Keywords: Asian openbill stork, Chlamydia spp., Wild bird
How to cite this article:
Parut S, Rattanaporn O, Witthawat W, Nareerat S, Paisin L, Ladawan S. Occurrence of Chlamydia spp. in wild birds in Thailand. Asian Pac J Trop Med 2019;12:67-71 |
How to cite this URL:
Parut S, Rattanaporn O, Witthawat W, Nareerat S, Paisin L, Ladawan S. Occurrence of Chlamydia spp. in wild birds in Thailand. Asian Pac J Trop Med [serial online] 2019 [cited 2023 Apr 2];12:67-71. Available from: https://www.apjtm.org/text.asp?2019/12/2/67/250839 |
Foundation project: This work was financially supported by the Faculty of Veterinary Science, Mahidol University. The sample used in this study were collected by the project of Establishment of zoonotic viral networking system: developmental phase; subproject of Influenza A virus surveys in migratory and residence birds of Thailand granting from Cluster and Program Management Office (P-15-50535), the National Science and Technology Development Agency, Thailand.
| 1. Introduction | |  |
Chlamydosis is an infectious disease of several animal species, including wild birds and humans. The disease is caused by an obligate intracellular gram-negative bacteria in the family Chlamydiaceae. To date, Chlamydiaceae comprises 11 species, namely Chlamydia psittaci (C. psittaci), Chlamydia felis(C. felis), Chlamydia abortus (C. abortus), Chlamydia avium, Chlamydia caviae, Chlamydia gallinacea, Chlamydia muridarum, Chlamydia pecorum, Chlamydia suis, Chlamydia pneumoniae, and Chlamydia trachomatis, and three candidate chlamydial species, namely Chlamydia ibidis, Chlamydia sanzinia, and Chlamydia corallus[1],[2],[3],[4],[5],[6]. Within the chlamydial species, C. psittaci, C. felis, and C. abortus have zoonotic potential[7]. Chlamydiosis in birds can range from asymptomatic infection to severe disease with life-threatening illness, depending on the host species affected and the chlamydial species involved. Wild birds are important to public health because they can be infected with Chlamydia species that are transmissible to humans and domestic animals[8]. Several reports have shown the prevalence of Chlamydia in wild birds. In 2015, the positive rate for chlamydial DNA in wild birds in Poland was 7.3% (27/369)[9]. Two years later, a large number of wild birds in Poland were tested, and the results revealed Chlamydiaceae prevalence of 14.8% (132/894)[10]. Moreover, 10.3% (125/1 214) of wild birds in Austria and the Czech Republic have been found to be Chlamydia spp. positive[11].
The lowest prevalence was reported in Korea[12], Only 2.7% (6/225) of wild birds in Korea were found to be positive to Chlamydia DNA; four (1.8%, 4/225) and two (0.9%, 2/225) were positive for C. psittaci and C. gallinacea, respectively[12]. In Thailand, a few studies have sought to detect Chlamydia in wild birds. Of 407 feral pigeons, 44 (10.8%) were positive for Chlamydiaceae, with most of the positive samples C. psittaci[13]. One report examined C. psittaci in captive psittacine birds and found 7.9% (14/178) prevalence[14]. Thus, the aim of this study is to determine the occurrence of Chlamydia spp. in various species of wild birds in Thailand.
| 2. Materials and Methods | | |
2.1. Sample collection and genomic DNA extraction
During 2017-2018, tracheal and cloacal swabs of 313 wild birds from 11 orders and 51 species from seven provinces in Thailand were collected and examined [Table 1]. The samples were kept in VB lysis buffer (Geneaid, Taiwan) and transferred to the laboratory in a cool chain within 48 hours. At the laboratory, genomic DNA was extracted from the samples using the viral nucleic acid extraction kit Π (Geneaid, Taiwan). The animal handling protocol used during sample collection and the samples used in this study were approved by the Animal Care and Use Committee of the Faculty of Veterinary Science, Mahidol University (Protocol No. MUVS-2017-02-04 and MUVS 2018-01-02).
2.2. Housekeeping gene detection
Before detection of Chlamydiaceae, the samples were examined the quality of the DNA by detection of the 12S ribosomal (r) DNA housekeeping gene using primers 12S rDNA-F (5’ GGATTAGATACCCCACTATGC 3’) and 12S rDNA-R (5’ AGGGTGACGGGCGGTATGTAC G 3’) and obtained a PCR product with a size of 436 bp[15]. In total a 25 μL, the PCR mixture contained 1× PCR buffer with 0.2 mM MgCl2, 2.5 units of i- Taq DNA polymerase (iNtRON, South Korea), 1 mM of dNTPs, 0.5 μΜ of each primer, and 3 pL of template DNA. The PCR reaction was worked under the conditions of 2 min at 94 °C for initial denaturing, followed by 30 cycles of 15 s at 94 °C, 15 s at 60 °C, and 30 s at 72 °C, and was terminated at 72°C for 7 min.
2.3. Chlamydiaceae detection
Chlamydiaceae was detected by primers CHY-F (5’ GCCTACCGGCTTACCAAC 3’) and CHY-R (5’ GGCGCAATGATTCTCGAT 3’) targeting the 16S rRNA gene of the Chlamydiaceae family[16]. The PCR mixture contained 1 mM of dNTPs, 1X PCR buffer with 0.2 mM MgCl2, 2.5 units of i- Taq DNA polymerase (iNtRON, South Korea), 0.5 μΜ of each primer, and 3 μΕ of template DNA. Sterile DNase/RNase-free distilled water was added to increase the mixture to 25 μΕ. The PCR reaction was performed under the conditions of 2 min at 94°C for initial denaturing, followed by 35 cycles of 15 s at 94 °C, 30 s at 56 °C, and 30 s at 72 °C, and was terminated at 72 C for 7 min. The primers generated a PCR product with a size of 230 bps.
2.4. ompA gene amplification and phylogenetic tree construction
The positive samples from the Chlamydiaceae detection protocol were used for amplification of the ompA gene. The ompA gene was amplified with primers CTU (5’- ATGAAAAAACTCTTGAAATCGG-3’) and CTL (5’ CAAGATTTTCTA GAYTTCATYTTGTT 3’). The primers generated a PCR product with a size of 1 070 bps[17]. The PCR mixture contained 3 μΕ of template DNA, 1× PCR buffer with 0.2 mM MgCl2, 1 mM of dNTPs, 2.5 units of i- Taq DNA polymerase (iNtRON, South Korea), and 0.5 μΜ each of forward and reverse primer. The PCR reaction was worked under the conditions of 2 min at 94°C for initial denaturing, followed by 35 cycles of 30 s at 94°C, 30 s at 58 °C, and 30 s at 72 °C, and was terminated at 72 C for 7 min. After that, DNA fragment of each sample was ligated to the pGEM-T easy vector (Promega, USA) and transformed to competent Escherichia coli TOP10 (Invitrogen™, USA) using the calcium chloride method. Transformants were selected by blue-white screening method. Plasmid was extracted by the QIAprep spin miniprep kit (QIAGEN, Germany) and submitted to Macrogen Inc. (South Korea) for DNA sequencing. A phylogram of deduced amino acid sequences of the ompA gene was generated by the maximum likelihood method and the JTT matrix-based model with a bootstrap value based on 1 000 replicates[18]. Evolutionary analyses were conducted with MEGA7 version 7.0 software[19].
| 3. Results | | |
For all bird samples, the housekeeping gene (12S rDNA) was detected to examine the quality of the DNA. All samples were found to be positive for the 12S rDNA gene, indicating the good quality of the DNA. For Chlamydiaceae detection, of 313 wild birds, two (0.64%) were positive for Chlamydiaceae with asymptomatic infection. These birds were Asian openbill storks (Anastomus oscitans), which belong to the order Ciconiiformes. The positive rate for Asian openbill storks was 4.9% (2/41). The ompA gene of the positive samples was amplified and sequenced. Nucleotide sequencing of the ompA gene (Accession No. MK007613 and MK007614) in our study showed only 94.1% genetic similarity to Chlamydia spp. of Eurasian magpies (Pica pica) and mute swans (Cygnus olor) in Poland (Accession No. KX870484.1, KX424658.1, KX062052.1, KX062055.1). The ompA phylogenetic tree analysis showed that the Chlamydia spp. detected in Asian openbill storks can be grouped together with 99% bootstrap support and was closely related to Chlamydia spp. detected in Eurasian magpies and mute swans in Poland but had a different cluster creation with a 95% bootstrap value [Figure 1]. Additionally, the Chlamydia spp. found in this study had a closer relationship to C. abortus than any other known Chlamydia. | Figure 1: Phylogenetic tree resulting from analysis of deduced amino acid sequences of the Chlamydiaceae ompA gene.
The percentage of trees in which the associated taxa are clustered together is shown next to the branches. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. The sequences analyzed in this study are indicated by a black rhombus.
Click here to view |
| 4. Discussion | | |
Wild birds may play a role as a potential source of Chlamydiaceae that can be transmitted to humans, domestic animals, and poultry[8],[20],[21]. In the present study, we demonstrated the overall occurrence of Chlamydia spp. in several species of wild birds was 0.64%, suggesting low occurrence in wild birds in Thailand. The primers used in this study can detect Chlamydiaceae DNA as low as 1 fg, indicating high sensitivity of the test[16]. The occurrence found in the study was slightly lower than the rate in other countries, which ranges from 2.7% to 14.8%, depending on the bird species and detection method[9],[10],[12]. Phylogram-based ompA gene analysis of the positive samples found that the Chlamydia detected is closely related to Chlamydia detected/isolated in wildfowl in Poland and to C. abortus, which causes abortion and fetal death in ewes and goats, and abortion in women in close contact with aborting animals[7]. The wildfowl Chlamydia strains can presumably be classified as avian C. abortus based on MLST analysis. However, the pathogenicity of the avian C. abortus strains from wildfowl remains unknown[10]. The positive samples detected in our study were from Asian openbill storks in the order Ciconiiformes. A 4.9% prevalence level was found for these birds. Other species in Ciconiiformes were previously reported as having a Chlamydiaceae positive rate of 5.3% (2/38) for white storks[10] and 11.5% (13/113) for herons and allies[20], respectively. The variation of prevalence in Ciconiiformes may depend on the sample size of birds. However, to the best of the authors’ knowledge, Chlamydiaceae has not been previously reported in Asian openbill storks. The Asian openbill stork is a migratory bird, and the migration of Asian openbill stork populations along various migration pathways may be a potential means of spreading of Chlamydiaceae. Asymptomatic birds can transmit the bacterium to domestic birds and humans that share their environment or habitat or by handling via fecal shedding and direct contact. In conclusion, this study demonstrates the occurrence of Chlamydia spp. in wild birds in Thailand is 0.64%. Chlamydia spp. in Asian openbill stork could be a potential source of infection in domestic animals, poultry, and humans who share their habitat.
Conflict of interest statement
The author declared that they have no conflict of interest.
Foundation project
This work was financially supported by the Faculty of Veterinary Science, Mahidol University. The sample used in this study were collected by the project of Establishment of zoonotic viral networking system: developmental phase; subproject of Influenza A virus surveys in migratory and residence birds of Thailand granting from Cluster and Program Management Office (P-15-50535), the National Science and Technology Development Agency, Thailand.
| References | | |
| 1. | Stephens RS, Myers G, Eppinger M, Bavoil PM. Divergence without difference: Phylogenetics and taxonomy of Chlamydia resolved. FEMS Immunol Med Microbiol 2009; 55 (2): 115-119.  |
| 2. | Everett KD. Chlamydia and Chlamydiales: More than meets the eye. Vet Microbiol 2000; 75 (2): 109-126. |
| 3. | Vorimore F, Hsia RC, Huot-Creasy H, Bastian S, Deruyter L, Passet A, et al. Isolation of a new Chlamydia species from the feral sacred ibis (Threskiornis aethiopicus): Chlamydia ibidis. PLoS One 2013; 8 (9): e74823. |
| 4. | Sachse K, Laroucau K, Riege K, Wehner S, Dilcher M, Creasy HH, et al. Evidence for the existence of two new members of the family Chlamydiaceae and proposal of Chlamydia avium sp. nov. and Chlamydia gallinacea sp. nov. Syst Appl Microbiol 2014; 37 (2): 79-88. |
| 5. | Taylor-Brown A, Bachmann NL, Borel N, Polkinghorne A. Culture- independent genomic characterisation of Candidatus Chlamydia sanzinia, a novel uncultivated bacterium infecting snakes. BMC Genomics 2016; 17: 710. |
| 6. | Taylor-Brown A, Spang L, Borel N, Polkinghorne A. Culture-independent metagenomics supports discovery of uncultivable bacteria within the genus Chlamydia. Sci Rep 2017; 7 (1): 10661. |
| 7. | Essig A, Longbottom D. Chlamydia abortus: New aspects of infectious abortion in sheep and potential risk for pregnant women. Curr Clin Microbiol Rep 2015; 2 (1): 22-34. |
| 8. | Reed KD, Meece JK, Henkel JS, Shukla SK. Birds, migration and emerging zoonoses: West Nile virus, lyme disease, influenza A and enteropathogens. Clin Med Res 2003; 1 (1): 5-12. |
| 9. | Krawiec M, Piasecki T, Wieliczko A. Prevalence of Chlamydia psittaci and other Chlamydia species in wild birds in Poland. Vector Borne Zoonotic Dis 2015; 15 (11): 652-655. |
| 10. | Szymanska-Czerwinska M, Mitura A, Niemczuk K, Zareba K, Jodelko A, Pluta A, et al. Dissemination and genetic diversity of chlamydial agents in Polish wildfowl: Isolation and molecular characterisation of avian Chlamydia abortus strains. PLoS One 2017; 12 (3): e0174599. |
| 11. | Konicek C, Vodrazka P, Bartak P, Knotek Z, Hess C, Racka K, et al. Detection of zoonotic pathogens in wild birds in the cross-border region Austria-Czech Republic. J Wildl Dis 2016; 52 (4): 850-861. |
| 12. | Jeong J, An I, Oem JK, Wang SJ, Kim Y, Shin JH, et al. Molecular prevalence and genotyping of Chlamydia spp. in wild birds from South Korea. J Vet Med Sci 2017; 79 (7): 1204-1209. |
| 13. | Sariya L, Prompiram P, Tangsudjai S, Poltep K, Chamsai T, Mongkolphan C, et al. Detection and characterization of Chlamydophila psittaci in asymptomatic feral pigeons (Columba livia domestica) in central Thailand. Asian Pac J Trop Med 2015; 8 (2): 94-97. |
| 14. | Suksai P, Lorsunyaluck B, Dittawong P, Sanyathitiseree P, Lertwatcharasarakul P. Genetic detection and identification of Chlamydophila psittaci in captive psittacine birds in Thailand. Thai J Vet Med 2016; 46 (1): 67-75. |
| 15. | Miyaki C, Matioli S, Burke T, Wajntal A. Parrot evolution and paleogeographical events: Mitochondrial DNA evidence. Mol Biol Evol 1998; 15 (5): 544-551. |
| 16. | Condon K, Oakey J. Detection of Chlamydiaceae DNA in veterinary specimens using a family-specific PCR. Lett Appl Microbiol 2007; 45 (2): 121-127. |
| 17. | Denamur E, Sayada C, Souriau A, Orfila J, Rodolakis A, Elion J. Restriction pattern of the major outer-membrane protein gene provides evidence for a homogeneous invasive group among ruminant isolates of Chlamydia psittaci. J Gen Microbiol 1991; 137 (11): 2525-2530. |
| 18. | Kimura M. A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. J Mol Evol 1980; 16 (2): 111-120. |
| 19. | Kumar S, Stecher G, Tamura K. MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol Biol Evol 2016; 33 (7): 1870-1874. |
| 20. | Kaleta EF, Taday EM. Avian host range of Chlamydophila spp. based on isolation, antigen detection and serology. Avian Pathol 2003; 32 (5): 435-461. |
| 21. | Szymanska-Czerwinska M, Niemczuk K. Avian chlamydiosis zoonotic disease. Vector Borne Zoonotic Dis 2016; 16 (1): 1-3. |
[Figure 1]
[Table 1]
|
Search Pubmed for